Status
Please wait ...

Classification of Transcription Factors in Mammalia

About TFClass

Search in TFClass:

Searches in the label, ID and external references.

Go to the search of TRANSFAC



Superclass: , Class: ,
Family: , Subfamily: , Genus: ,
  • 6 Immunoglobulin fold
    • 6.3 p53 domain factors
General

Consensus binding sequenceGGACATGCCCGGGCATGTCCPredicted binding sites For: human, mouse, cow, dogSpecies within this Family: 34 Genera within this Family: 3 LOGO plot of the DNA binding domain
FASTA file of the LogoPlot
DNA binding domain Whole protein
FASTA FASTA file FASTA file
Phylogenetic tree
Mammalia
These trees (or cladograms, since distances were ignored) were generated with a local installation of PhyML 3.0 (Guindon et al., Systematic Biology, 59(3):307-21, 2010.), by webPRANK at EBI (http://www.ebi.ac.uk/goldman-srv/webprank/), or by the web version of PhyML 3.0 (http://phylogeny.lirmm.fr). The resulting trees were visualized with iTOL v3 (http://itol.embl.de/).
  • webPRANK and iTOL
  • Phylogeny.fr and iTOL
  • Phylogeny.fr and iTOL
  • webPRANK and iTOL
Phylogenetic tree Mammalia
(slim selection)
To generate these trees, only the TFs were taken from a selected group of mammalian species. As standard, the corresponding human, cow, mouse and Monodelphis TFs were taken if available; occasionally, either species was to replaced or had to be omitted without replacement.
    • Phylogeny.fr and iTOL
    Select species

    Selected the species for which a species report should be shown.

    Expression table
    The table below summarizes the protein expression data from the Protein Atlas. The tissues and cell types are linked to the Cytomer ontology

    The selected tree node is not linked to a gene, no expression data is available.